검색어 입력폼

PCR의 원리 이해 및 Primer 디자인

저작시기 2008.02 |등록일 2008.02.06 한글파일한글 (hwp) | 3페이지 | 가격 2,000원

소개글

PCR의 원리 이해 및 Primer 디자인인에 대하여 실험목적 및 원리에대하여 레포트한것입니다.
교수님께 A+ 받은 레포트니깐 많은 도움되실것으로 압니다.^^

목차

1. 주제
2. 실험목적
3. 실험원리
4. 실험재료
5. 실험방법
6. Result
7. Discussion

본문내용

1. 주제: PCR의 원리 이해 및 Primer 디자인
2. 실험목적: 특정 DNA를 PCR하는 방법을 알고, 전기영동 결과를 통해 sequence의 size를 확인한다.
3. 실험원리: 이미 알고 있는 특정 DNA부위와 특이적으로 결합하는 primer를 제작하고 이를 이용해 반복 합성하여 PCR-tube 내에 원하는 DNA분자를 증폭시키는 방법으로서 미량의 DNA를 다량으로 얻을 수 있는 분자생물학적으로 중요한 기법이다. 이와 같이 증폭된 DNA는 Cloning 등의 분자생물학 실험, 유전성 질병인 진단, 감염성 질환의 진단 등에 다양하게 이용된다.
4. 실험재료: Template: pBSIIKS + sGFP, primer(Forward, Reverse), 10mM dNTP, Ex-Taq polymerase, 10x Buffer, D.D.W, pipet, PCR기기, tip, tube.
5. 실험방법
DDW
41.2㎕
10x Buffer
5㎕
Template
1㎕
Forward
primer
1㎕
Reverse
primer
1㎕
10mM dNTP
0.5㎕
Ex-Taq
polymerase
0.3㎕
①옆의 표의 순서로 위에서부터 아래로 pipet으로 tube에 넣어 준다.

②Tube의 mixture가 잘 섞이도록 손으로 Tapping 한다.(3회)

③약하기 centrifuge 한다. - 몇 초만

④PCR기기에 35cycle 정도 돌린다.



⤷온도에 민감함, 가장 나중에 넣어 준다.
6.Result
1) Primer Design
⦁Forward Primer: 5` AATCTGCAGATGGTGAGCAAGGGCGAGGA 3`
⦁Reverse Primer : 5` ATAGTCGACCTTGTACAGCTCGTCCATGC 3`
extra sequence↲ ⤷restriction enzyme

2) 전기영동 결과 (PCR 35 cycle후)
M 4-2 4-1 3-2 3-1 2-2 2-1 1-2 1-1
- Marker가 아래에서부터 100,200... 표시되어 있으므로, 우리분반의 band는 700bp 부근에 서 관찰되었음을 알 수 있다.
↳ 우리가 증폭하고자한 sequence가 700bp 였으므로 PCR이 잘되었음을 알 수 있다.
- 전체적으로 증폭된 양은 작아서 흐렸지만, 특히 3, 4조의 band가 연하게 관찰되었다.

참고 자료

http://blog.naver.com/ryu1903?Redirect=Log&logNo=140009940728
유럽 분자생물학회(European Molecular Biology Organisation ; EMBO)가 발간하는 학술지 “EMBO 보고(EMBO Reports)”, 온라인 속보판, 7월 9일자(doi : 10.1038/sj.embor.7400200)에 소개됨.
다운로드 맨위로